View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18804_high_22 (Length: 277)
Name: NF18804_high_22
Description: NF18804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18804_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 260
Target Start/End: Complemental strand, 14948113 - 14947862
Alignment:
| Q |
15 |
actttgttctctttcaagatacaaagatgtaccttaccaacatagtattatattcccttggttgttatgttgctaaga-----tgagccctattactcat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
14948113 |
actttgttctctttcaagatacaaagatgtaccttaccaacatagtattatattcccttggttgttatgttgccaagacccattgagccctattactcat |
14948014 |
T |
|
| Q |
110 |
tcattccaaagat-tttaggatattatcatgcttgaagacattttccagccctatatttcgaagaacattgttgtctttcaacaaaagattttgcctgaa |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
14948013 |
tcattccaaagatctttaggatattatcatgcttcaagacattttccagccctatatttcgaagaacatcgttgtctttcaacagaagattttgcctgaa |
14947914 |
T |
|
| Q |
209 |
ttttccatatggtcaatttggaaagctcgaaatgagattgcaaatgtttggt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14947913 |
ttttccatatggtcaatttggaaagctcgaaatgagattgcaaatgtttggt |
14947862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University