View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18804_low_10 (Length: 389)
Name: NF18804_low_10
Description: NF18804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18804_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 17 - 167
Target Start/End: Complemental strand, 24634270 - 24634123
Alignment:
| Q |
17 |
atatcatcaatctcttcctcttactcgttacttcattatgtttcttgaactgcacccttattaatatcactaagctcttccgttcaaatgatgcccaccc |
116 |
Q |
| |
|
||||||||||||| ||||| ||| | |||| ||||||||||||||| ||||||| ||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
24634270 |
atatcatcaatctattccttttaatggttatttcattatgtttcttcaactgcatcctta---atatccctaagctcttccgttcaaatgatgctcaccc |
24634174 |
T |
 |
| Q |
117 |
tccaaatttggaacaacaagaagctcaggtttaaggcttgatttcatggat |
167 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24634173 |
ttcaaatttggaacaacaagaagctcaggtttaaggcttgatttgatggat |
24634123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 197 - 296
Target Start/End: Complemental strand, 24634093 - 24633994
Alignment:
| Q |
197 |
aaatgtgaagaatgtaacagcacacatgagtagtgagaaaatagaaaacacctataacaaaaattgatgctgtttaacagttttctttttatgaaattag |
296 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||||||||||||||||| ||| ||| |||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
24634093 |
aaatgtgaaaaatgtaatagcacacatgactagtgagaaaatagaaaacacctctaataaatgttgatgctatttaacaattttctttttatgaagttag |
24633994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 314 - 365
Target Start/End: Complemental strand, 24703868 - 24703817
Alignment:
| Q |
314 |
tttttatgaaattagttagtggttgcaatcaatgtatacatctttatacata |
365 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24703868 |
tttttatgaagttagttagtggttgcaatcaatgtatacatctttttacata |
24703817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 314 - 373
Target Start/End: Complemental strand, 24634008 - 24633949
Alignment:
| Q |
314 |
tttttatgaaattagttagtggttgcaatcaatgtatacatctttatacatattatgtca |
373 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||| | |||||| ||||| |
|
|
| T |
24634008 |
tttttatgaagttagttagtggttgcaatcaatgtatacgtctttttgcatattctgtca |
24633949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 351
Target Start/End: Complemental strand, 24646628 - 24646595
Alignment:
| Q |
318 |
tatgaaattagttagtggttgcaatcaatgtata |
351 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
24646628 |
tatgaagttagttagtggttgcaatcaatgtata |
24646595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University