View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18804_low_22 (Length: 281)
Name: NF18804_low_22
Description: NF18804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18804_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 22 - 267
Target Start/End: Original strand, 10434903 - 10435148
Alignment:
| Q |
22 |
tgaggtaaaggcttaactggagctttagcaggagtcttctttactgcttctgcttttggagcttcttcttttacctcctcctttgtttcagcagtagcta |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10434903 |
tgaggtaaaggcttaactggagctttagcaggagtcttctttactgctgctgcttttggagcttcttcctttacctcctcctttgtttcagcagtagcta |
10435002 |
T |
 |
| Q |
122 |
aaaccacaaattttacttacattacagtttcaaaaccaaaattaatgatttaatttgtgcacaacatcatgcgtaaaaatgttttatatacgaatccaat |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
10435003 |
aaaccacaaattttaattacattacagtttcaaaaccaaaattaatgatttaatttgtgcacaacatcaagcctaaaaatgttttatatacgaatccgat |
10435102 |
T |
 |
| Q |
222 |
cacacttaatcagtgtgacgttcctaaaatatctttacaaatatct |
267 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10435103 |
catacttaatcagtgtgacgttcctaaaacatctttacaaatatct |
10435148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University