View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18804_low_26 (Length: 234)
Name: NF18804_low_26
Description: NF18804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18804_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 11 - 217
Target Start/End: Original strand, 8782813 - 8783019
Alignment:
| Q |
11 |
aatttgtttcataattggctgccaacagatgtgcaaaggagaattgaagctattatgcctccaaagggaaatataggtgatgaagtgtgttttagtgcta |
110 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8782813 |
aatttgtttcataattggctgccaacaaatgtgcaaagaagaattatagctattatgcctccaaagggaaatatatgtgatgaagtgtgttttagtgcta |
8782912 |
T |
 |
| Q |
111 |
ctggttcgcatgatggattttgtgttgcagcaatgtatgcattcttaagtaatactccacatgagaatgttgcttcaaagtggaggcaagtgtggagact |
210 |
Q |
| |
|
| |||||| || ||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8782913 |
caggttcgtataatggattttgtgttgcagccatgtatgcattcttaagtaatgctccacaagagaatgttgcttcaaagtggaggcaagtgtggagact |
8783012 |
T |
 |
| Q |
211 |
taaagtg |
217 |
Q |
| |
|
||||||| |
|
|
| T |
8783013 |
taaagtg |
8783019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University