View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18805_low_1 (Length: 273)
Name: NF18805_low_1
Description: NF18805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18805_low_1 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 25 - 273
Target Start/End: Complemental strand, 47735943 - 47735694
Alignment:
| Q |
25 |
taaataaattaagttaccaacggaaattatggaccgaaaaaa-tgatatatgtaacacttagcaacgaaattatgaacggatttcatttttagtactgac |
123 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735943 |
taaataaattgagttaccaacggaaattatggaccgaaaaaaatgatatatgtaacacttagcaacgaaattatgaacggatttcatttttagtactgac |
47735844 |
T |
 |
| Q |
124 |
aatgtaagaatttgcagggaacggcgttactctttgatttaaaccatcaattaccattgacaatggaagttgaatccttggaatttgttatagcaaggtg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735843 |
aatgtaagaatttgcagggaacggcgttactctttgatttaaaccatcaattaccattgacaatggaagttgaatccttggaatttgttatagcaaggtg |
47735744 |
T |
 |
| Q |
224 |
gccattctttgtcttcttaggtggttcaatgttctgtctcctctctagca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735743 |
gccattctttgtcttcttaggtggttcaatgttctgtctcctctctagca |
47735694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University