View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18806_high_3 (Length: 296)
Name: NF18806_high_3
Description: NF18806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18806_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 25 - 277
Target Start/End: Complemental strand, 7209998 - 7209746
Alignment:
| Q |
25 |
attttgcacactaggactcatagtcaaattaagagattgaaaaccatttccatcactagaagttgttttcccctcagaagaaaactgagtttgagtcatc |
124 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7209998 |
attttgcacacaaggactcatagtcaaattaagagattgaaaaccatttccatcactagaagttgttttcccctcagaagaaaactgagtttgagtcatc |
7209899 |
T |
 |
| Q |
125 |
caagatttatacatgctattatcatggattaaagcatgatgattgttgttgctgtgatcattatatgcatgaaaagagtgaatcaaagattggtttgtta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7209898 |
caagatttatacatgctattatcatggattaaagcatgatgattgttgttgctgtgatcattatatgcatgaaaagagtgaatcaaagattggtttgtta |
7209799 |
T |
 |
| Q |
225 |
gattcttccttgtgtcaatctctggattattattggtacaaaaacttggtgac |
277 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7209798 |
gattctcccttgtgtcaatctctggattattattggtacaaaaacttggtgac |
7209746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University