View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18807_high_15 (Length: 238)
Name: NF18807_high_15
Description: NF18807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18807_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 62 - 220
Target Start/End: Complemental strand, 4081035 - 4080877
Alignment:
| Q |
62 |
cattgtccatatccaatctcgaatatataaaagtaaaaaacaaattataaggacatgcagaagattggcttccctaagaacaacaaaaacatattaataa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
4081035 |
cattgtccatatccaatctcgaatatataaaagcaaaaaacaaattataaggacatgcagaagattggcttccctaaggacaacaaaagcatattaataa |
4080936 |
T |
|
| Q |
162 |
actcatatcaggccaaggaatgcttctcacctagataattaaaaggcataccacatgta |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4080935 |
actcatatcaggccaaggaatgcttctcacctagataattaaaaggcataccacatgta |
4080877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University