View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18807_low_6 (Length: 503)
Name: NF18807_low_6
Description: NF18807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18807_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 413; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 413; E-Value: 0
Query Start/End: Original strand, 1 - 482
Target Start/End: Complemental strand, 35481518 - 35481047
Alignment:
| Q |
1 |
agagggaggtggagaatgatgatgggttttatttggtaaaagatgatggtaatgatgttggtttaaaggttcaaaggggttcgattttgaaggaaatggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35481518 |
agagggaggtggagaatgatgatgggttttatttggtaaaagatgatggtaatgatgttggtttaaaggttcaaaggggttcgattttgaaggaaatggg |
35481419 |
T |
 |
| Q |
101 |
ggttaatgagtgtttagggaatgtagttattgttgttaggccacctactgaaaatgatggtgatatgttgagtgaagaagattgggattgaaatgaagat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35481418 |
ggttaatgagtgtttagggaatgtagttattgttgttagaccacctactgaaaatgatggtgatatgttgagtgaagaagattgggattgaaatgaag-- |
35481321 |
T |
 |
| Q |
201 |
tgggttaaaggattggattaggaattgtagtcaagtgagtttcaatctcttttccctttcttccttacctttgnnnnnnngggtcctgcggaatatggct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35481320 |
-gggttaaaggattggattaggaattgtagtcaagtgagtttcaatctcttttccctttcttccttacctttgtttttttgggtcctgcggaatatggct |
35481222 |
T |
 |
| Q |
301 |
ctttattaatttgggtttagttgcaatattcttttgctttgcctacttaatagaaggacttgatcatttttgttttctctatagcttgtatgttatcttt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35481221 |
ctttattaatttgggtttagttgcaatattcttttgctttgcctacttaatagaaggacttgatcatttttgttttctctatagcttgtacgttatcttt |
35481122 |
T |
 |
| Q |
401 |
acatggttaaaggtgaataatatagccaattattgcattgaaagttgaaacatctatctgttcagtttagtcatctttgttt |
482 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35481121 |
acatggttaaaggtgaataatatagccaattattgca-------ttgaaacatctatctgttcagtttagtcatctttgttt |
35481047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University