View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18808_low_12 (Length: 295)
Name: NF18808_low_12
Description: NF18808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18808_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 20 - 288
Target Start/End: Complemental strand, 32229638 - 32229371
Alignment:
| Q |
20 |
acattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtatgttgttgattaatttgatattgttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32229638 |
acattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtatgttgttgattaatttgatattgttc |
32229539 |
T |
|
| Q |
120 |
agggtttgttgatggtacatgaatgattaattgtttgtttctttgtttgtgttgcatgaattgtattattcatatttaacgttgttgattgtgctctaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32229538 |
agggtttgttgatggtacatgaatgattaattgtttgtttctttgtttgtgttgcatgaattgtattattcatatttaacgttgttgattgtgctctaag |
32229439 |
T |
|
| Q |
220 |
tattttatgaaaggcttgaatgataatattttttgtcttattctttgttgtagatatcactgatgatgt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32229438 |
tattttatgaaaggcttgaatgataatatttttt-tcttattctttgttgtagatatcactgatgatgt |
32229371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University