View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18808_low_17 (Length: 223)
Name: NF18808_low_17
Description: NF18808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18808_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 14438615 - 14438801
Alignment:
| Q |
19 |
gtagataatcatgatttaaaagattctaaaagaatccacgctcctttttccaaagttttggatgagaggaagtttgtgtttccattcatgatttggttga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14438615 |
gtagataatcatgatttaaaagattctaaaagaatccccgctcccttttccaaagttttggatgagaggaagtttgtgtttccattcatgatttggttga |
14438714 |
T |
|
| Q |
119 |
taaagacgatttaacagtgac-----aaaagggtattgatatcatatat-aaaatttagatttcataactaaatactactttgccta |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14438715 |
taaagacgatttaacagtgacaaattaaaagggtattgatatcatatataaaaatttagatttcataactaaatactactttgccta |
14438801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University