View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18808_low_7 (Length: 384)
Name: NF18808_low_7
Description: NF18808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18808_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 9 - 368
Target Start/End: Complemental strand, 14931891 - 14931532
Alignment:
| Q |
9 |
gacatcatcagttgcatctgcggcatcggaaccggaacctgcaccgaaccggatacaccaggaggttgattagggttttgataaccaccaggtggattcg |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14931891 |
gacatcataggttgcatctgcggcatcggaaccggaacctgcaccgaaccggatacaccaggaggttgattagggttttgataaccaccaggtggattcg |
14931792 |
T |
|
| Q |
109 |
gcagaggagtgaactgtggtaattgagcaccaagcggtcggaaggacggtgcagaaggaggaagaacaccgggaatttgcggcggagcatataaagtagg |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14931791 |
gcagaggagtgaactgcggtaattgagcaccaagcggtcggaaggacggtgcagaaggaggaagaacaccgggaatttgcggcggagcatataaagtagg |
14931692 |
T |
|
| Q |
209 |
cggtggaggtagcgactgtggattgggattagggtttgtaacgatggggattggtgatggtgttgaagattgtgattgcgattgggatgattggggaatt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14931691 |
cggtggaggtagcgactgtggattgggattaaggtttgtaacgatggggactggtgatggtgttgaagattgtgattgcgattgggatgattggggaatt |
14931592 |
T |
|
| Q |
309 |
ggatcgggtggattagggattgggttaggaggagaaggttctgaattggtttgaggattg |
368 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14931591 |
ggatcgggtggattgaggattgggttaggaggagaaggttctgaattggtttgaggattg |
14931532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 7e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 261 - 368
Target Start/End: Complemental strand, 10841307 - 10841199
Alignment:
| Q |
261 |
ggtgatggtgttgaagattgtgattgcgattgggatgattggggaattggatcgggtgg-attagggattgggttaggaggagaaggttctgaattggtt |
359 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| |||||||| ||||||||||||||||| ||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
10841307 |
ggtgaaggcgttgaagattgcgattgcgattgtgatgattgaggaattggatcgggtgggattagggattgggttgggaggtgaaggttctaaattggtt |
10841208 |
T |
|
| Q |
360 |
tgaggattg |
368 |
Q |
| |
|
||||||||| |
|
|
| T |
10841207 |
tgaggattg |
10841199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University