View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_high_23 (Length: 413)
Name: NF18809_high_23
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 13 - 396
Target Start/End: Original strand, 44547587 - 44547970
Alignment:
| Q |
13 |
aatatagagatctgcgtgggagtagcaaaacctataagggagatcatgatggaaagtcttttcttgatcatcatcttggtaagtaggatttggccattct |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44547587 |
aatacagagatctgcgtgggagtagcaaaacctataagggagatcatgatggaaagtcttttcttgatcatcatcttggtaagtaggatttggccatcct |
44547686 |
T |
 |
| Q |
113 |
cttaattagtaatagcattcaacttgttgtgtttgcaattgcattgctataactttaataagtttatttgtctacgcttatgtgaagttactgttttcac |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44547687 |
cttaattagtaatagcatacaacttgttgtgtttgcaattgcattgctataactttaataagtttatttgtctatgcttatgtgaagttactgttttcac |
44547786 |
T |
 |
| Q |
213 |
tttgaatatggatcagttcaaaccactttgaaaatgtgatgcaacaattttcccaattgggacgaatactggctttgttattttgaaattttgcaactga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547787 |
tttgaatatggatcagttcaaaccactttgaaaatgtgatgcaacaattttcccaattgggacggatactggctttgttattttgaaattttgcaactga |
44547886 |
T |
 |
| Q |
313 |
gatatgtgcttcatgttgtagatcttctaaaggaattagaagcagctcgtgatgatttccccaaagttttgcgtctcctgcgtg |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547887 |
gatatgtgcttcatgttgtagatcttctaaaggaattagaagcagctcgtgatgatttccccaaagttttgcgtctcctgcgtg |
44547970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University