View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_high_57 (Length: 238)
Name: NF18809_high_57
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_high_57 |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0154 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 5017 - 5232
Alignment:
| Q |
1 |
gttgaatttactatttctatactttaattagaatattatatccttcattcaactcataatacaaccgataatatatatgctatcaatcaaatagtttaaa |
100 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017 |
gttgcatttactatttcaatactttaattagaatattatatccttcattcaactcataatacaaccgataatatatatgctatcaatcaaatagtttaaa |
5116 |
T |
 |
| Q |
101 |
agtcataaatcatattcataaagtaactattttcttcttagttaagtgaaacaagttggtttttgctataatataaatgccaaattgaaatacctcttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5117 |
agtcataaatcatattcataaagtaacta-tttcttcttagttaagtgaaacaagttggtttttgctataatataaatgccaaattgaaatacctcttgt |
5215 |
T |
 |
| Q |
201 |
a--ctcctcattccaat |
215 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
5216 |
actctcctcattccaat |
5232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University