View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_high_59 (Length: 237)
Name: NF18809_high_59
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_high_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 38 - 134
Target Start/End: Complemental strand, 31220588 - 31220492
Alignment:
| Q |
38 |
agataaccttgtatgcttaacatattctttaaggtaggttggtcactactgtggtggatagatgtgttgttcttaattttcagaaccaaattaaata |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31220588 |
agataaccttgtatgcttaacatattctttaaggtaggttggtcactactgtggtggatagatgtgttgttcttaattttcagaacctaattaaata |
31220492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 166 - 221
Target Start/End: Complemental strand, 31182612 - 31182557
Alignment:
| Q |
166 |
acacaagcttataattaattatgatgcagtgttctcaaatcacaaaatctttctgg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31182612 |
acacaagcttataattaattatgatgcagtgttctcagatcacaaaatctttctgg |
31182557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 31201657 - 31201605
Alignment:
| Q |
166 |
acacaagcttataattaattatgatgcagtgttctcaaatcacaaaatctttc |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31201657 |
acacaagcttttaattaattatgatgcagtgttctcagatcacaaaatctttc |
31201605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 31220312 - 31220260
Alignment:
| Q |
169 |
caagcttataattaattatgatgcagtgttctcaaatcacaaaatctttctgg |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
31220312 |
caagcttataattaattatggtgcagtgttctcaagtcacaaaatctttctgg |
31220260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 178
Target Start/End: Complemental strand, 31220470 - 31220433
Alignment:
| Q |
141 |
tttagaacctaattttcgaggtgctacacaagcttata |
178 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
31220470 |
tttagaacctaattttcaaggtgctacaaaagcttata |
31220433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 218
Target Start/End: Complemental strand, 31236759 - 31236726
Alignment:
| Q |
185 |
tatgatgcagtgttctcaaatcacaaaatctttc |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
31236759 |
tatgatgcagtgttctcaagtcacaaaatctttc |
31236726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University