View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18809_low_12 (Length: 517)

Name: NF18809_low_12
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18809_low_12
NF18809_low_12
[»] chr5 (1 HSPs)
chr5 (16-187)||(40812577-40812748)
[»] chr8 (1 HSPs)
chr8 (160-198)||(20471112-20471150)


Alignment Details
Target: chr5 (Bit Score: 168; Significance: 8e-90; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 168; E-Value: 8e-90
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 40812748 - 40812577
Alignment:
16 atatatgatgtattgtttgttacttcccacaaaccatatggatttggagttcctgctatgggagttgaatgcgtgcatgcatgaacagttgaacacactg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
40812748 atatatgatgtattgtttgttacttcccacaaaccatatggatttggagttcctgctgtgggagttgaatgcgtgcatgcatgaacagttgaacacactg 40812649  T
116 tgcctttgtatgtcatgaatctgttatgtgcctttgtacctactcaaattgggatgataattgattccttct 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40812648 tgcctttgtatgtcatgaatctgttatgtgcctttgtacctactcaaattgggatgataattgattccttct 40812577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 160 - 198
Target Start/End: Complemental strand, 20471150 - 20471112
Alignment:
160 caaattgggatgataattgattccttctagcgaatgatt 198  Q
    |||||||||||| ||||||||||||||||| ||||||||    
20471150 caaattgggatgttaattgattccttctagtgaatgatt 20471112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University