View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_low_12 (Length: 517)
Name: NF18809_low_12
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 8e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 8e-90
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 40812748 - 40812577
Alignment:
| Q |
16 |
atatatgatgtattgtttgttacttcccacaaaccatatggatttggagttcctgctatgggagttgaatgcgtgcatgcatgaacagttgaacacactg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812748 |
atatatgatgtattgtttgttacttcccacaaaccatatggatttggagttcctgctgtgggagttgaatgcgtgcatgcatgaacagttgaacacactg |
40812649 |
T |
 |
| Q |
116 |
tgcctttgtatgtcatgaatctgttatgtgcctttgtacctactcaaattgggatgataattgattccttct |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812648 |
tgcctttgtatgtcatgaatctgttatgtgcctttgtacctactcaaattgggatgataattgattccttct |
40812577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 160 - 198
Target Start/End: Complemental strand, 20471150 - 20471112
Alignment:
| Q |
160 |
caaattgggatgataattgattccttctagcgaatgatt |
198 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
20471150 |
caaattgggatgttaattgattccttctagtgaatgatt |
20471112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University