View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_low_39 (Length: 343)
Name: NF18809_low_39
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 17 - 310
Target Start/End: Original strand, 27618344 - 27618635
Alignment:
| Q |
17 |
tattttgtttaagtcataaaagtgtcttttgaagaacatggttacccatgaggaaatcatagtttgaacacatgaagattctgtctcccattaatatgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27618344 |
tattttgtttaagtcataaaagtgtcttttgaagaacatggtcacccatgaggaaatcttagtttgaacacatgaagattctgtctcccattaatctgaa |
27618443 |
T |
 |
| Q |
117 |
ttttctagcaaaaatgaagtaatccacacatgcacataaagtcatcaagaaagtgaaagtcaattaacgatatacacattatgatgtgcacatttttgtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27618444 |
ttttctagcaaaaatgaagtaatccata--tgcacataaagtcatcaaggaagtgaaagtcaattaacgatatacacattatgatgtgcacatttttgtt |
27618541 |
T |
 |
| Q |
217 |
acgtatattctccagaattttcttatcagtttaataaactaaccgtttctatcaaaaattagcaaggtaattaagtcatatctcatgttcctct |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27618542 |
acgtatattctccagaattttcttatcagtttaataaactaaccgtttctatcaaaaattagcaaggtaattaagtcatatctcatgttcctct |
27618635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University