View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_low_55 (Length: 253)
Name: NF18809_low_55
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 35918346 - 35918159
Alignment:
| Q |
18 |
aagtggcggtggaaggggagggggatgggatggagccgtaggtggcggtggttgtggtggtcggcatttgggagaggtggtggatctgaaatcagtgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35918346 |
aagtggcggtggaaggggagggggatgggatggagccgtaggtggcggtggttgtggtggtcggcatttgggagaggtggtggatctgaaatcagtgaaa |
35918247 |
T |
 |
| Q |
118 |
tgtgtgcatgtttgacaaatttagggttttgtgtttgagatgcgaatcgaattagatttgggaatttgagagagaaaggggatgcatgtg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35918246 |
tgtgtgcatgtttgacaaatttagggttt--tgtttgagatgcgaatcgaattagatttgggaatttgagagagaaaggggatgcatgtg |
35918159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University