View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_low_66 (Length: 238)
Name: NF18809_low_66
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_low_66 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 40647925 - 40648143
Alignment:
| Q |
1 |
cactagaatcaattttggaggagcaaaagggtctgcctttaccttttccttgtccgcttttcaatttcagttgacaagtgctatgatgnnnnnnngttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40647925 |
cactagaatcaattttggaggagcaaa-gggtctgcctttaccttttccttgtccgcttttcaatttcagttgacaagtgctatgatgaaaaaa-gttaa |
40648022 |
T |
 |
| Q |
101 |
aaacgcaaacagaatcacaaatcgtatcttccaaacacaaaacaatcaatatctttcaacaacgtaac-----tattgtattgtactacagaaacacacg |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
40648023 |
aaactcaaacagaatcacaaatcgtatcttccaaacacaaaacaatcaatatctttcaacaacgtaactattgtattgtattgtactacacaaacacacg |
40648122 |
T |
 |
| Q |
196 |
aactacggagtacagacataa |
216 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40648123 |
aactacggagtacagacataa |
40648143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University