View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_low_71 (Length: 235)
Name: NF18809_low_71
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_low_71 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 2452140 - 2451910
Alignment:
| Q |
1 |
agaggcttgttgggtgggaagattcatacatttttggaaggttttagtagaggtttctacagtgcagtgagatgaaaaaccaatgtgaggaaggaaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2452140 |
agaggcttgttgggtgggaagattcatacatttttggaaggttttagtagaggtttctacagtgcagtgagatgaaaaaccaatgtgaggaaggaaacac |
2452041 |
T |
 |
| Q |
101 |
atttggagaaggaagacataaacaagaaacatgatggtgcagtggtagatggagaattgcactagtggatggtttatttggtttgtaaagctttatcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2452040 |
atttggagaaggaagacataaacaagaaacatgatggtgcagtggtagatggagaattgcactagtggatggtttatttggtttgtaaagctttatcttt |
2451941 |
T |
 |
| Q |
201 |
atgcaaaagatttgtattttgtgatgatgtc |
231 |
Q |
| |
|
||||||| |||||||||||||| |||||||| |
|
|
| T |
2451940 |
atgcaaacgatttgtattttgtaatgatgtc |
2451910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 2 - 99
Target Start/End: Original strand, 42769392 - 42769489
Alignment:
| Q |
2 |
gaggcttgttgggtgggaagattcatacatttttggaaggttttagtagaggtttctacagtgcagtgagatgaaaaaccaatgtgaggaaggaaaca |
99 |
Q |
| |
|
||||||||||| || ||||||||||| |||||||| ||||||||||| || |||||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
42769392 |
gaggcttgttgtgtaggaagattcatgcatttttgaaaggttttagtggaagtttctgttgtgcagtgagatgagaaaacaatgtgaggaaggaaaca |
42769489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University