View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18809_low_72 (Length: 227)

Name: NF18809_low_72
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18809_low_72
NF18809_low_72
[»] chr2 (1 HSPs)
chr2 (6-227)||(1413149-1413369)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 1413149 - 1413369
Alignment:
6 agaagatatgtttttccatagtccacaatcatcttgaaagcatctatgaatatcacaagaaaaaattaatgttagggtaagaannnnnnnatacataaca 105  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||       ||||||||||    
1413149 agaagatatgtttttccatagtccacaatcatcttgaaagtatctatgaatatcacaagaaaaaattaatgttagggtaagaatttttttatacataaca 1413248  T
106 tatgtagagtttaataattatatagaccgacaaagaggaatgttaacggcacatcctttaacacacactctttgattcgttaaaatatgatttgatagtg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |    
1413249 tatgtagagtttaataattatatagaccgacaaagaggaatgttaacggcacatcctttgacacacactctttgattcgttaaaatatga-ttgatagcg 1413347  T
206 taggaggggggtggaccttttt 227  Q
    ||||||||||||||||||||||    
1413348 taggaggggggtggaccttttt 1413369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University