View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18809_low_74 (Length: 216)
Name: NF18809_low_74
Description: NF18809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18809_low_74 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 44411410 - 44411597
Alignment:
| Q |
18 |
catggatctcttctctctgcatcgaaaaccacacttccatctcacactaccttcttgcccggtaatgttctaatctttatttttctttacttagtcgtag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44411410 |
catggatctcttctctctgcatcgaaaaccacacttccatctcacactaccttcttgcccggtaatgttctaatctttatttttctttacttagtcgtag |
44411509 |
T |
 |
| Q |
118 |
atagaatgattttccggttggtttgtgtatttgaatttagtgtttgtaaaattcgatgcttttatacttttagttctacactaatatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44411510 |
atagaatgattttccggttggtttgtgtatttgaatttagtgtttgtaaaattcgatgcttttatacttttagttctacactaatatt |
44411597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 23 - 73
Target Start/End: Original strand, 429927 - 429977
Alignment:
| Q |
23 |
atctcttctctctgcatcgaaaaccacacttccatctcacactaccttctt |
73 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
429927 |
atctcttctttctgcatccaaaaccacacttcaatctcacactaccttctt |
429977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University