View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18810_high_12 (Length: 326)
Name: NF18810_high_12
Description: NF18810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18810_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 32 - 249
Target Start/End: Original strand, 2173890 - 2174099
Alignment:
| Q |
32 |
tttggtaaaatcaatctacattcatctttgtaggaacttcttctctccttctttggtgggcgg--ttgggagctcttggctcaattgcgggaagccatgc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
2173890 |
tttggtaaaatcaatctacattcatctttgtaggaacttcttctctccttctttggtggggggggtagggagctcttggctcaattgcgggaagccatgc |
2173989 |
T |
 |
| Q |
130 |
ccccatcaaaggtagtaannnnnnnaattgaaataattgttggattccttaccaacaagattgattgaacttggcgaggcgaggggtctttcgaaaggat |
229 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2173990 |
ccc-atcaaaggtagtaa---------ttgaaataattgttggattccttaccaacaagattgattgaacttggcgaggcgaggggtctttcgaaaggat |
2174079 |
T |
 |
| Q |
230 |
gggctagaaaattgtatttg |
249 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2174080 |
gggctagaaaattgtatttg |
2174099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 308
Target Start/End: Original strand, 2174542 - 2174574
Alignment:
| Q |
276 |
gtatcacttttatttctccttttctaataaaat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2174542 |
gtatcacttttatttctccttttctaataaaat |
2174574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University