View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18810_high_14 (Length: 296)
Name: NF18810_high_14
Description: NF18810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18810_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 3 - 290
Target Start/End: Original strand, 9198400 - 9198687
Alignment:
| Q |
3 |
tcgatacaccatttcatcttcgtataaggtactagtgttggatttgtcttcaatgtcagcaaattcttggtgcaaatgctctatcttcgggggattacgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9198400 |
tcgatacaccatttcatcttcgtataaggtactagtgttggatttgtcttcaatgtcagcaaattcttggtgcaaatgctctatcttcgggggattgcgc |
9198499 |
T |
 |
| Q |
103 |
acctttagtatgcttcggtcgagaactggagggacggagagtggtaaacctcttgctaattctccccatgagttcacaaactccatagctccaattccat |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9198500 |
acctttagtatgcttcggtcaagaactggagggacggagagtggtaaacctcttgctaattctccccatgagttcacaaactccattgctccaattccat |
9198599 |
T |
 |
| Q |
203 |
caaacatacagtgattcatgcatagtccaagagagaaacctccacatctgaacttggtcagctgaaatataaaatttaatcagtgatc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9198600 |
caaacatacagtgattcatgcatagtccaagagaaaaacctccacatttgaacttggtcagctgaaatataaaatttactcagtgatc |
9198687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University