View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18810_high_19 (Length: 252)

Name: NF18810_high_19
Description: NF18810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18810_high_19
NF18810_high_19
[»] chr1 (1 HSPs)
chr1 (199-237)||(9540597-9540635)


Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 199 - 237
Target Start/End: Complemental strand, 9540635 - 9540597
Alignment:
199 tgcatttagtttctttctccccaatttaagcaaaataat 237  Q
    |||||||||||||||||||||||||||||||||||||||    
9540635 tgcatttagtttctttctccccaatttaagcaaaataat 9540597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University