View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18810_low_15 (Length: 293)
Name: NF18810_low_15
Description: NF18810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18810_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 283
Target Start/End: Complemental strand, 5967017 - 5966753
Alignment:
| Q |
19 |
gtgatatccatgtcgaattatggggtccaaggaatccattgtattaatccaaaccctaaggtgtgggagagaaatgtgtaaccataagggacatgggaac |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5967017 |
gtgatatccatgttgaattatggggtccaaggaatccattgtattaatccaaaccctaaggtgtgggagagaaatgtgtaaccataagggacatgggaac |
5966918 |
T |
 |
| Q |
119 |
tttaaatatttcttgatagcattcactatggattctgtctaaaccatgtccctttatgactttaatctaaaaataccttaatagaccaaaacgcaaagct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5966917 |
tttaaatatttcttgatagcattcactatggattctgtctaaaccatgtccctttatgactttaatctaaaaataccttaatagaccaaaacgcaaagct |
5966818 |
T |
 |
| Q |
219 |
gtagaacactaacaagacatgtaagcacgtgaaatgctcgtgagtggaaatggtttttgcctttg |
283 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5966817 |
gtagaacactaacaagacatgtaaacacgtgaaatgctcgtgagtggaaatggtttttgcctttg |
5966753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University