View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18810_low_24 (Length: 221)
Name: NF18810_low_24
Description: NF18810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18810_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 38108262 - 38108086
Alignment:
| Q |
1 |
ctttctctctgttcattttgattggattcatgaaagnnnnnnnnnnnggaaagaagttgaaatatatggagcattgagagaagaaaccataaaccaagac |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38108262 |
ctttgtctctgttcattttgattggattcatgaaagaaaaaaaaaaaggaaagaagttgaaatatatggagcattgagagaagaaaccataaaccaagac |
38108163 |
T |
|
| Q |
101 |
tattcaaaattattagtataatttggagtttagaatggctgccagacggttgcttcgttgcgtaggtttccgtttctaatcaaacaaatgat |
192 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38108162 |
tattcaaaattat---tataatt------------tggctgccagacggttgcttcgttgcgtaggtttccatttctaatcaaacaaatgat |
38108086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University