View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18811_high_9 (Length: 213)
Name: NF18811_high_9
Description: NF18811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18811_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 49 - 195
Target Start/End: Original strand, 2354961 - 2355107
Alignment:
| Q |
49 |
ataaacactgagatcattgaaacattgaaaatataaggtgagagagactttaaataatttaacaccatttttaagtactttattataaatagattctagt |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2354961 |
ataaacactgagatcattgaaacattgaaaataaaaggtgagagagactttaaataatttaacaccatttttaagtactttattataaatagattctagt |
2355060 |
T |
 |
| Q |
149 |
tataccaaactaaattttgtctatgttttgtttgagagtgggcttta |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355061 |
tataccaaactaaattttgtctatgttttgtttgagagtgggcttta |
2355107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University