View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18811_low_6 (Length: 296)
Name: NF18811_low_6
Description: NF18811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18811_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 40 - 174
Target Start/End: Complemental strand, 4632701 - 4632567
Alignment:
| Q |
40 |
ttattattgtccataaattctaactcaactctagaaagaaaaaatattaaaattcttatgttggacactttgatttggattcaaaaacctgattcctaca |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
4632701 |
ttattattgtccataaattctaactcaactctagaaagaaaaaatattaaaattcttatgttggacattttgatttggattcaaaaaccttattcctaca |
4632602 |
T |
|
| Q |
140 |
tttgcatatgtgagtttccaatatccatccataca |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4632601 |
tttgcatatgtgagtttccaatatccatccataca |
4632567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 198 - 278
Target Start/End: Complemental strand, 4632569 - 4632493
Alignment:
| Q |
198 |
acaaacaattgaatcttcatgttggagc-caggtttagtgaagtgagaactgagacaagttttgtctgcgataaggataccc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||| |||||||||||||||| |
|
|
| T |
4632569 |
acaaacaattgaatcttcatgttggagcacaggtttagtga-----gagctgagacaagttttgtttgcgataaggataccc |
4632493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University