View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18811_low_7 (Length: 283)
Name: NF18811_low_7
Description: NF18811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18811_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 63 - 278
Target Start/End: Original strand, 11254766 - 11254981
Alignment:
| Q |
63 |
aaacatgaacatgtttatggaaactttacctttaaattagtgaaagaagaagcatgagaatctagaactactcaaagaatcttgtatatgttagttgtta |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
11254766 |
aaacatgaacatgtttatggaaacattaccttaaatttagtgaaagaagaagcatgagaatctagaactactcaaagaatctggtatatattagttgtta |
11254865 |
T |
 |
| Q |
163 |
taggattaagagcagactcaaagagagatatacaatagtttagagttgcttggaagattctacttcctctatgagccaagaaaaaccgactaatatattt |
262 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11254866 |
taggattaagagcagatccaaagagagatatacaatagtttagagttgcttggaagattctacttcctctatgagccaagaaaaaccgaataatatattt |
11254965 |
T |
 |
| Q |
263 |
ttatgagtataattta |
278 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
11254966 |
ttatgagtttaattta |
11254981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University