View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18811_low_8 (Length: 240)

Name: NF18811_low_8
Description: NF18811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18811_low_8
NF18811_low_8
[»] chr7 (1 HSPs)
chr7 (1-237)||(2267642-2267878)
[»] chr3 (1 HSPs)
chr3 (103-223)||(650355-650476)


Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 2267642 - 2267878
Alignment:
1 ttgttctagtggctagtctctgatactcagttttaagacttgaatgagcaacttgttgctgctttttagaccaccatgaaaataaactagtttcaaagta 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2267642 ttgttccagtggctagtctctgatactcagttttaagacttgaatgagcaacttgttgctgctttttagaccaccatgaaaataaactagtttcaaagta 2267741  T
101 tgtgctagaccctgaattagagcacctgtcatcagggttagatgcccaattggcatctcaaaatacctgtaaatgagatgactggtctggcagtaaaaga 200  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2267742 tgtgctagaccctgaattagagcacctgtcatcagggttggatgcccaattggcatctcaaaatacctgtaaatgagatgactggtctggcagtaaaaga 2267841  T
201 aggccatgatcagtggagcctttaagataccgccgaa 237  Q
    |||||||||||||||||||||||||||||||||||||    
2267842 aggccatgatcagtggagcctttaagataccgccgaa 2267878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 103 - 223
Target Start/End: Complemental strand, 650476 - 650355
Alignment:
103 tgctagaccctgaattagagcacctgtcatcagggttagatgcccaattggcatctcaaaatacctgt-aaatgagatgactggtctggcagtaaaagaa 201  Q
    ||||||||||| || |||| |||||||||||||||| |||| ||||||||||||| |||||||||||| ||| ||  |||||| |||| | ||||||||     
650476 tgctagaccctaaagtagatcacctgtcatcagggtcagattcccaattggcatcgcaaaatacctgtaaaacgatgtgactgatctgtcggtaaaagat 650377  T
202 ggccatgatcagtggagccttt 223  Q
    ||||||||||||| ||||||||    
650376 ggccatgatcagttgagccttt 650355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University