View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18811_low_9 (Length: 213)

Name: NF18811_low_9
Description: NF18811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18811_low_9
NF18811_low_9
[»] chr6 (1 HSPs)
chr6 (49-195)||(2354961-2355107)


Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 49 - 195
Target Start/End: Original strand, 2354961 - 2355107
Alignment:
49 ataaacactgagatcattgaaacattgaaaatataaggtgagagagactttaaataatttaacaccatttttaagtactttattataaatagattctagt 148  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2354961 ataaacactgagatcattgaaacattgaaaataaaaggtgagagagactttaaataatttaacaccatttttaagtactttattataaatagattctagt 2355060  T
149 tataccaaactaaattttgtctatgttttgtttgagagtgggcttta 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
2355061 tataccaaactaaattttgtctatgttttgtttgagagtgggcttta 2355107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University