View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18812_high_7 (Length: 253)
Name: NF18812_high_7
Description: NF18812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18812_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 37712302 - 37712527
Alignment:
| Q |
20 |
accttagcacaattgcacccatgtagtagatgccaaccaactttggcaccgtataaaaagatggaaaaggattattattatcttggttaaagctcaaatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37712302 |
accttagcacaattgcacccatgtagtagatgccaaccaactttggcaccgtataaaaagatggaaaaggattattattatcttggttaaagctcaaatc |
37712401 |
T |
 |
| Q |
120 |
tactaaaaagatgattgaacctacactcacatgtgataaagaatgggtagtgtaacgactaatgggtggtgaataaaattggagtagtagtggatacata |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37712402 |
tactaaaaagataattgaacctacactcacatgtgataaagaatgggtagtgtaacgactaatgggtggtgaataaaattggagtagtagtggatacata |
37712501 |
T |
 |
| Q |
220 |
cacttcatgaggttttctatattctt |
245 |
Q |
| |
|
|| ||||||||||||||||| ||||| |
|
|
| T |
37712502 |
catttcatgaggttttctattttctt |
37712527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University