View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18813_low_7 (Length: 246)
Name: NF18813_low_7
Description: NF18813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18813_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 38005832 - 38006069
Alignment:
| Q |
1 |
cttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattataggtaggaaacggaggacggtgagctggagatcaccgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005832 |
cttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattataggtaggaaacggaggacggtgagctggagatcaccgac |
38005931 |
T |
 |
| Q |
101 |
attggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctgggttggcggaggagggtggcgatttggttgtagattttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005932 |
attggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctgggttggcggaggagggtggcgatttggttgtagattttg |
38006031 |
T |
 |
| Q |
201 |
agttcgttgaggatagagagaggggtggttgatgatgt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38006032 |
agttcgttgaggatagagagaggggtggttgatgatgt |
38006069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 26461981 - 26461747
Alignment:
| Q |
1 |
cttcaaacccggcttgcggttttctatccgcgactcgtgagagataaactccggcgattataggtaggaaacggaggacggtgagctggagatcaccgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||| ||||| |||||||| || || |||||||| ||||||||||| ||||||||| || |
|
|
| T |
26461981 |
cttcaaacccggcttgcggttttctatcagcgacgcgtgagaggtaaacaccggcgataatcgggaggaaacgtaggacggtgagttggagatcagtgat |
26461882 |
T |
 |
| Q |
101 |
attggattggaaagtgtcatagagccaacgacaaagattgttgtcgccagcaccggagctgggttggcggaggagggtggcgatttggttgtagattttg |
200 |
Q |
| |
|
||| |||||||||||||| |||||||||||||||||||||||||| || || |||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26461881 |
atttgattggaaagtgtcgtagagccaacgacaaagattgttgtcaccggcgccggagttgggttggcggaggagggtggcgatttggttgtagatttcg |
26461782 |
T |
 |
| Q |
201 |
agttcgttgaggatagagagaggggtggttgatga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26461781 |
ggttcgttgaggatagagagaggggtggttgatga |
26461747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University