View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18817_high_8 (Length: 304)
Name: NF18817_high_8
Description: NF18817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18817_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 22 - 289
Target Start/End: Original strand, 40998229 - 40998499
Alignment:
| Q |
22 |
atcatcacttagattgatcaattcgatcttattttcattaccttgctattgtctatttatcgtgattcaaacacaccatggcaaacaactctcttccccc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40998229 |
atcatcacttagattgatcaattcgatcttatttttattaccttgctattgtctatttatcgtgattcaaacacaccatggcaaacaactctcttccccc |
40998328 |
T |
 |
| Q |
122 |
actctcaaccctcgccgtccccatttgaaaactcccataatcaagtgtttggcaagctaattcaattttacggaag---tgacacattttgaaaacttaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
40998329 |
actctcaaccctcgccgtccccatttgaaaactcccataattaagtgtttggtatgctaattcaattttacggaggtgatgacacattttgaaaacttaa |
40998428 |
T |
 |
| Q |
219 |
gttgacccaagggccaagagccaagcaatccatccaagactcaaattcatcatatttgtatggacgaaaaa |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
40998429 |
gttgacccaagggccaagagccaagcaatccatccaagactcaaactcatcatatttgtaaggaccaaaaa |
40998499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University