View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18817_low_6 (Length: 343)
Name: NF18817_low_6
Description: NF18817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18817_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 325
Target Start/End: Original strand, 32101667 - 32101985
Alignment:
| Q |
16 |
atgcatatctaaccgggggaaaaactgcattgataatatgtatactgctacttcatatgataacttttagcaatacctcttttatcacaaaatttannnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32101667 |
atgcatatctaaccgggggaaaaactgcattgataatatgtatactgctacttcatatgataacttttagcaatacctcttttatcacaaaatttatttt |
32101766 |
T |
 |
| Q |
116 |
nnngtgttaaaggaaagatatttcaaaacctaacttagcataattcgtactagctagtatatatgtttattcaatttttgcagcttgcatga-------- |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32101767 |
tttgtgttaaaggaaagatatttcaaaacctaacttagcataattcgtactagctagtatatatgtttattcaatttttgcagcttgcatgatttttttt |
32101866 |
T |
 |
| Q |
208 |
-nnnnnnnnnngcatttaacaacaggctttcctctcttatggagagaaaccataatttctctattctcctaactagagtacatataaatatttagtgtct |
306 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32101867 |
tttttttttttgcatttaacaacaggctttcctctctcatggagataaaccataatttctctattctcctaactagagtacatatatatatttagtgtct |
32101966 |
T |
 |
| Q |
307 |
atgagtataataatagtat |
325 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
32101967 |
ataagtataataatagtat |
32101985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University