View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18818_high_5 (Length: 403)
Name: NF18818_high_5
Description: NF18818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18818_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 2e-90; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 211 - 395
Target Start/End: Complemental strand, 26556681 - 26556497
Alignment:
| Q |
211 |
ttcatagaataatggatgaagtgggtagcagctgtgagtggagcagagatcaagacaaagcatttgaaaatacattggcgaattatccggaggacgctgt |
310 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26556681 |
ttcacagaataatggatgaagtgggtagcagctgtgagtggagcagagatcaagacaaagcatttgaaaatacattggcgaattatcccgaggacgctgt |
26556582 |
T |
|
| Q |
311 |
ggatcgatgggtgaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtcgctatgtggttttgtttgatgat |
395 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26556581 |
ggatcgatgggagaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtcactatgtggttttgtttgatgat |
26556497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 81 - 157
Target Start/End: Complemental strand, 26556752 - 26556676
Alignment:
| Q |
81 |
atcactacactatgtaatctaatcttattcttttgaatttgaattttgaatcaaaatcacgattgaagtaattcaca |
157 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26556752 |
atcactgcactatgtaatctaaacttattcttttgattttgaattttgaatcaaaatcacgattgaagtaattcaca |
26556676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 273 - 395
Target Start/End: Original strand, 26776056 - 26776178
Alignment:
| Q |
273 |
tttgaaaatacattggcgaattatccggaggacgctgtggatcgatgggtgaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtc |
372 |
Q |
| |
|
|||||| || ||||||| |||||||| || || | |||||||||||||| ||| |||||||| | |||||| ||||||||||| ||| | ||||||| || |
|
|
| T |
26776056 |
tttgaatatgcattggccaattatcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaaaactttggaacaaattaaacatc |
26776155 |
T |
|
| Q |
373 |
gctatgtggttttgtttgatgat |
395 |
Q |
| |
|
||||| ||||||| | |||||| |
|
|
| T |
26776156 |
actatgaggttttggtagatgat |
26776178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 367
Target Start/End: Original strand, 12130607 - 12130752
Alignment:
| Q |
222 |
atggatgaagtgggtagcagctgtgagtggagcagagatcaagacaaagcatttgaaaatacattggcgaattatccggaggacgctgtggatcgatggg |
321 |
Q |
| |
|
||||||||||||| | |||| |||||||||| | || |||||||| |||||||||||| | |||| || ||||| ||||| | | ||||||||||| |
|
|
| T |
12130607 |
atggatgaagtggacaatagctctgagtggagctgggagcaagacaaggcatttgaaaatgccttggtgacgtatcctgaggatgattcggatcgatggg |
12130706 |
T |
|
| Q |
322 |
tgaaaattgcggctgatgtgcccgggaaaactttagaagagattaa |
367 |
Q |
| |
|
||| ||||||| ||||| || ||||| ||| | ||||| ||||| |
|
|
| T |
12130707 |
agaagattgcggtcgatgtaccggggaagactatggaagaaattaa |
12130752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University