View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18818_low_6 (Length: 403)

Name: NF18818_low_6
Description: NF18818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18818_low_6
NF18818_low_6
[»] chr8 (3 HSPs)
chr8 (211-395)||(26556497-26556681)
chr8 (81-157)||(26556676-26556752)
chr8 (273-395)||(26776056-26776178)
[»] chr1 (1 HSPs)
chr1 (222-367)||(12130607-12130752)


Alignment Details
Target: chr8 (Bit Score: 169; Significance: 2e-90; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 211 - 395
Target Start/End: Complemental strand, 26556681 - 26556497
Alignment:
211 ttcatagaataatggatgaagtgggtagcagctgtgagtggagcagagatcaagacaaagcatttgaaaatacattggcgaattatccggaggacgctgt 310  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
26556681 ttcacagaataatggatgaagtgggtagcagctgtgagtggagcagagatcaagacaaagcatttgaaaatacattggcgaattatcccgaggacgctgt 26556582  T
311 ggatcgatgggtgaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtcgctatgtggttttgtttgatgat 395  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
26556581 ggatcgatgggagaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtcactatgtggttttgtttgatgat 26556497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 81 - 157
Target Start/End: Complemental strand, 26556752 - 26556676
Alignment:
81 atcactacactatgtaatctaatcttattcttttgaatttgaattttgaatcaaaatcacgattgaagtaattcaca 157  Q
    |||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
26556752 atcactgcactatgtaatctaaacttattcttttgattttgaattttgaatcaaaatcacgattgaagtaattcaca 26556676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 273 - 395
Target Start/End: Original strand, 26776056 - 26776178
Alignment:
273 tttgaaaatacattggcgaattatccggaggacgctgtggatcgatgggtgaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtc 372  Q
    |||||| || ||||||| |||||||| || || | |||||||||||||| ||| |||||||| | |||||| ||||||||||| ||| | ||||||| ||    
26776056 tttgaatatgcattggccaattatcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaaaactttggaacaaattaaacatc 26776155  T
373 gctatgtggttttgtttgatgat 395  Q
     ||||| ||||||| | ||||||    
26776156 actatgaggttttggtagatgat 26776178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 367
Target Start/End: Original strand, 12130607 - 12130752
Alignment:
222 atggatgaagtgggtagcagctgtgagtggagcagagatcaagacaaagcatttgaaaatacattggcgaattatccggaggacgctgtggatcgatggg 321  Q
    |||||||||||||  |  |||| |||||||||| | || |||||||| |||||||||||| | |||| ||  ||||| ||||| | |  |||||||||||    
12130607 atggatgaagtggacaatagctctgagtggagctgggagcaagacaaggcatttgaaaatgccttggtgacgtatcctgaggatgattcggatcgatggg 12130706  T
322 tgaaaattgcggctgatgtgcccgggaaaactttagaagagattaa 367  Q
     ||| |||||||  ||||| || ||||| ||| | ||||| |||||    
12130707 agaagattgcggtcgatgtaccggggaagactatggaagaaattaa 12130752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University