View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_high_43 (Length: 241)
Name: NF18819_high_43
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_high_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 25 - 228
Target Start/End: Complemental strand, 9641001 - 9640798
Alignment:
| Q |
25 |
tctagcatattagtttgtttgaatagcaagtaaagaatttctgctgtgagtgttgaaatgagattaatatttctttgattaggctgcacttattggagga |
124 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9641001 |
tctagcatattagtttgtttgaatagcatgtaaagaatttctgctgtgagtgttgaaatgagattaatatttctttgattaggctgcacttattggagga |
9640902 |
T |
 |
| Q |
125 |
gtggacaacttgccaagatttttatcctatcaacgtattcctgtgattggtattgatgtagacccactttcagcatttatggtattgattgttacatgga |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9640901 |
gtggacaacttgccaagatttttatcctatcaacgtattcctgggattgatattgatgtagacccactttcagcatttatggtattgattgttacttgga |
9640802 |
T |
 |
| Q |
225 |
tcct |
228 |
Q |
| |
|
|||| |
|
|
| T |
9640801 |
tcct |
9640798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 100 - 228
Target Start/End: Complemental strand, 9632523 - 9632395
Alignment:
| Q |
100 |
tgattaggctgcacttattggaggagtggacaacttgccaagatttttatcctatcaacgtattcctgtgattggtattgatgtagacccactttcagca |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||| ||| |||| ||||| ||||||||||||||||||| ||||| |
|
|
| T |
9632523 |
tgattaggctgcacttattggaggtatggacaacttgccaggatttttatcatatcaacatatacctgggattgatattgatgtagacccacttgcagca |
9632424 |
T |
 |
| Q |
200 |
tttatggtattgattgttacatggatcct |
228 |
Q |
| |
|
|||||||||| |||||||| |||||||| |
|
|
| T |
9632423 |
attatggtattcattgttacttggatcct |
9632395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 73 - 228
Target Start/End: Complemental strand, 9657700 - 9657545
Alignment:
| Q |
73 |
agtgttgaaatgagattaatatttctttgattaggctgcacttattggaggagtggacaacttgccaagatttttatcctatcaacgtattcctgtgatt |
172 |
Q |
| |
|
|||||||| |||| ||| |||||| | |||||||||||| ||||||||||| ||||| ||||||||| ||||||||||| |||||| |||||||| |||| |
|
|
| T |
9657700 |
agtgttgatatgaaatttatatttttctgattaggctgcccttattggaggtgtggaaaacttgccaggatttttatccaatcaacatattcctgggatt |
9657601 |
T |
 |
| Q |
173 |
ggtattgatgtagacccactttcagcatttatggtattgattgttacatggatcct |
228 |
Q |
| |
|
| ||||| ||||||||||||||||||| ||||||| || ||||| || |||||||| |
|
|
| T |
9657600 |
gatattgttgtagacccactttcagcaattatggtgttcattgtcacctggatcct |
9657545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 104 - 231
Target Start/End: Complemental strand, 9617769 - 9617642
Alignment:
| Q |
104 |
taggctgcacttattggaggagtggacaacttgccaagatttttatcctatcaacgtattcctgtgattggtattgatgtagacccactttcagcattta |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||| ||||||| |||||||| ||||| ||||| ||||||||||||| ||||| || |
|
|
| T |
9617769 |
taggctgcacttattggaggtatggacaacttgccaggatttttatcatatcaacatattcctgggattgatattgttgtagacccacttgcagcaattg |
9617670 |
T |
 |
| Q |
204 |
tggtattgattgttacatggatcctatg |
231 |
Q |
| |
|
||||||| |||||||| ||||||||||| |
|
|
| T |
9617669 |
tggtattcattgttacttggatcctatg |
9617642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University