View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_high_52 (Length: 231)
Name: NF18819_high_52
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 2 - 218
Target Start/End: Original strand, 24978599 - 24978814
Alignment:
| Q |
2 |
tatgcaggcatttcagttgtgttatagttttgtgcaatctcatgttgaaccagttcaatgtcagggatggcaacaagaagattatcagtatgtttcttgc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978599 |
tatgcaggcatttcagttgtgttatagttttgtgcaatctcatgttgaaccagttcaatgtcagggatggcaacaagaagattatcagtatgtttcttgc |
24978698 |
T |
 |
| Q |
102 |
cattcagctcagacccaacgtgattctggccagacaagatacgagcaacaatgttcttgccaggcataacattgtcaacttgtttcttgttagacaagcc |
201 |
Q |
| |
|
||||||||||||||||||| ||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24978699 |
cattcagctcagacccaacatgattcttg-cagacaaggtacgagcaacaatgttcttgccaggcataacattgtcaacttgtttcttgctagacaagcc |
24978797 |
T |
 |
| Q |
202 |
attatcaacttgtttct |
218 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24978798 |
attatcaacttgtttct |
24978814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University