View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_high_58 (Length: 204)
Name: NF18819_high_58
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_high_58 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 28 - 204
Target Start/End: Complemental strand, 11288159 - 11287978
Alignment:
| Q |
28 |
taaatcaaacacttaaaatcaaaacaaataattttttataatgaagnnnnnnnnnaagagataaaaaagttaccactactactactacataggcatagta |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
11288159 |
taaatcaaacacttaaaatcaaaacaaataactttttataataaagattttttttaagagataaaaaagttac---tactactacttcataggcatagta |
11288063 |
T |
|
| Q |
128 |
gagtctagtatagtagtattactcataaatattgcattgtttttgtt--------catatacataggcaaatacttagataaaac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
11288062 |
gagtctagtatagtagtattactcataaatattgcattgtttttgttcataacttcatatacataggcaaatacatagataaaac |
11287978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University