View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_low_14 (Length: 402)
Name: NF18819_low_14
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_low_14 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 113 - 402
Target Start/End: Original strand, 25031974 - 25032263
Alignment:
| Q |
113 |
tacctgagggaaacgagattggtgcaattcaggagagaagaaggaaccagtacttgccggtcttcatcgcagtattcaagggaaacaaacagttcttcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031974 |
tacctgagggaaacgagattggtgcaattcaggagagaagaaggaaccagtacttgccggtcttcatcgcagtattcaagggaaacaaacagttcttcaa |
25032073 |
T |
 |
| Q |
213 |
gttgaggcccaatggcagcacgaacccatacgtcgaagcagtcgctacgaaacaagtcatcatccaccatgccgctggtgagactaaaccttttaatatc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25032074 |
gttgaggcccaatggcagcacgaacccatacgtcgaagcagtcgctacgaaaccagtcatcatccaccatgccgctggtgagacgaaaccttttaatatc |
25032173 |
T |
 |
| Q |
313 |
gcgggatcgatggagggagagcacggcgttgacgaagaatgcaaaccttctgaacattattggccagttgccgtcttcatgtgagtcgtc |
402 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
25032174 |
acgggaccgacggagggagagcacggcgttgacgaagaatgcaaaccttctgaacattattggccagttgccgtcttcgtatgagtcgtc |
25032263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 25031926 - 25031965
Alignment:
| Q |
11 |
cagagagagaacaagagatgaaatcatgaaagcaaccata |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031926 |
cagagagagaacaagagatgaaatcatgaaagcaaccata |
25031965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 113 - 152
Target Start/End: Complemental strand, 20505354 - 20505315
Alignment:
| Q |
113 |
tacctgagggaaacgagattggtgcaattcaggagagaag |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
20505354 |
tacctgagggaaacgagattggtgcaattcaagagggaag |
20505315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University