View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_low_25 (Length: 292)
Name: NF18819_low_25
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 103 - 286
Target Start/End: Original strand, 24572638 - 24572820
Alignment:
| Q |
103 |
acaccttataataataaaaaagcatcttttttcgtaatatattcaattgttttcgtaaaatcacgggtatttgtatcaattgttttcaatgtgaagtaga |
202 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24572638 |
acaccttatgctaataaaaaagcatcctttttcgtaatatattcaattgttttcgtaaaatcacgggtatttgtatcaattgttttcaatctgaagtaga |
24572737 |
T |
 |
| Q |
203 |
tagaatatatactttctttatnnnnnnnnnnnnnttaaacaaatccataattcataaatgtaacccgtacgtgtagaattattt |
286 |
Q |
| |
|
| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24572738 |
ttgaatatatactttctttat-aaatataaaaaattaaacaaatccataattcataaatgtaacccgtacgtgtagaattattt |
24572820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University