View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_low_30 (Length: 280)
Name: NF18819_low_30
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 13 - 265
Target Start/End: Original strand, 40260611 - 40260863
Alignment:
| Q |
13 |
aacctgtgactccaacgccatcaatcttcttctttgtctttcagattctaagtttgtttccaacttgatcaccttatcttgtatctcaggatcgttaaca |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40260611 |
aacctgtaactccaacgccatcaatcttcttctttgtctttcagattctaagtttgtttccaacttgatcaccttatcttgtatctcaggatcgttaaca |
40260710 |
T |
 |
| Q |
113 |
ccgttactagtagcaacagcaaaagtactagttgagcttgatcctaatcccatttcccaaacatccccagttgattgtaaatgtatagaggaaaatggat |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40260711 |
ctgttactagtagcaacagcaaaagtactagttgagcttgatcctaatcccatttcccaaacatccccagttgattgtaaatgtatagaggaaaatggat |
40260810 |
T |
 |
| Q |
213 |
tcctttcctgtataaatgaaaaatattactaccattgacataacacctaaact |
265 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40260811 |
tccattcctgtataaatgaaaaatattactaccattgacataacacctaaact |
40260863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University