View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_low_31 (Length: 267)
Name: NF18819_low_31
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 51180522 - 51180418
Alignment:
| Q |
1 |
ctgttcatcttttatccttaaaaaataaatcaaatatttttacaagaacgaattagtgtgtttttattaatattaattaattaaagtttgaattcgtgcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51180522 |
ctgttcatcttttatccttaaaaaataaatcaaatatttttacaagaacgaattagtgtgtttttattaatattaattaattaaagtttgaattcgtgcc |
51180423 |
T |
 |
| Q |
101 |
cttaa |
105 |
Q |
| |
|
||||| |
|
|
| T |
51180422 |
cttaa |
51180418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 204 - 258
Target Start/End: Complemental strand, 51180314 - 51180260
Alignment:
| Q |
204 |
gaatcgtaacttccaagttatgttttattttctaaatagaatctgacatattctt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51180314 |
gaatcgtaacttccaagttatgttttattttctaaatagaatctgacattttctt |
51180260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University