View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_low_36 (Length: 257)
Name: NF18819_low_36
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 49466090 - 49466319
Alignment:
| Q |
15 |
agtttattttattggggcattgtgttactattggattggagggagtgagaagaagatagttgagttcaattttgctataattgacatgctgtttggtgta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49466090 |
agtttattttattggggcattgtgttactattggattggagggagtgagaagaagatagttgagttcaattttgctataattgacatgctgtttggtgta |
49466189 |
T |
 |
| Q |
115 |
ctgtttgtgtcctgcttttacccattatgaagaccaggtacaaaagaatatcttctgattaaagaagagttgaggaaggtattgacaaagggaaaggctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49466190 |
ctgtttgtgtcctgcttttacccattatgaagaccaggtacaaaagaatatcttctgattaaagaagagttgaggaaggtattgacaaagggaaaggctg |
49466289 |
T |
 |
| Q |
215 |
caggtgtgcttcgtttggttttccatgatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49466290 |
caggtgtgcttcgtttggttttccatgatg |
49466319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 204 - 244
Target Start/End: Original strand, 52087769 - 52087809
Alignment:
| Q |
204 |
gggaaaggctgcaggtgtgcttcgtttggttttccatgatg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52087769 |
gggaaaggctgcaggtgtgcttcgtttggttttccatgatg |
52087809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University