View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_low_49 (Length: 237)
Name: NF18819_low_49
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 13121676 - 13121892
Alignment:
| Q |
19 |
tattgccgtaacaattgcagttgcagaccaccatttagaatactatctcgtgcttaaggatttgagatacagcctgcaaatggacggtaggatttggacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13121676 |
tattgccgtaacaattgcagttgcagaccaccatttagaatactatctcgtgcttacggatttgagatacagcctgcaaatggacggtaggatttggacc |
13121775 |
T |
 |
| Q |
119 |
cctcaaattagtcggtccttgagctggatatcaagttttagtatactatctcgttcttaaggataactaatgcatgaattattgctattgctgtttccat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13121776 |
cctcaaattagtcggtccttgagctggatatcaagttttagtatactatctcgttcttaaggataactaatgcatgaattattgctattgctgtttccat |
13121875 |
T |
 |
| Q |
219 |
cacccatgtgggctaag |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13121876 |
cacccatgtgggctaag |
13121892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 148
Target Start/End: Complemental strand, 40302708 - 40302655
Alignment:
| Q |
94 |
gcaaatggacggtaggatttggacccctcaaattagtcggtccttgagctggata |
148 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
40302708 |
gcaattggacggtgggatt-ggacccctcaaattagtcggtccttgggctggata |
40302655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University