View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18819_low_54 (Length: 228)
Name: NF18819_low_54
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18819_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 35 - 214
Target Start/End: Original strand, 3429834 - 3430026
Alignment:
| Q |
35 |
aaggaatgaacatcttaattagcaattttgatcagacataagtgaggctgtttatattgatcacgac--tatatgaaaaggtttgttaaggaacaaatgc |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
3429834 |
aaggaatgaacatcttaattagcaattttgatcagacataagtgaggctgtttatattgatcacgcctatatatgaaaaggtttgttaaggaacaaatgc |
3429933 |
T |
|
| Q |
133 |
aaaccaattgtaat------taattaggtctatggagccacatg---tattagattgggattg--ttctaaccaataacatgttggagagata |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3429934 |
aaaccaattgtaatcaatgacaattaggtctatggagccacatgtattattagattgggattgtattctaaccaataacatgttggagagata |
3430026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University