View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18819_low_59 (Length: 204)

Name: NF18819_low_59
Description: NF18819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18819_low_59
NF18819_low_59
[»] chr2 (1 HSPs)
chr2 (28-204)||(11287978-11288159)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 28 - 204
Target Start/End: Complemental strand, 11288159 - 11287978
Alignment:
28 taaatcaaacacttaaaatcaaaacaaataattttttataatgaagnnnnnnnnnaagagataaaaaagttaccactactactactacataggcatagta 127  Q
    ||||||||||||||||||||||||||||||| |||||||||| |||         ||||||||||||||||||   |||||||||| |||||||||||||    
11288159 taaatcaaacacttaaaatcaaaacaaataactttttataataaagattttttttaagagataaaaaagttac---tactactacttcataggcatagta 11288063  T
128 gagtctagtatagtagtattactcataaatattgcattgtttttgtt--------catatacataggcaaatacttagataaaac 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||| ||||||||||    
11288062 gagtctagtatagtagtattactcataaatattgcattgtttttgttcataacttcatatacataggcaaatacatagataaaac 11287978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University