View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1881_low_10 (Length: 230)

Name: NF1881_low_10
Description: NF1881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1881_low_10
NF1881_low_10
[»] chr6 (1 HSPs)
chr6 (18-152)||(9109786-9109920)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 152
Target Start/End: Complemental strand, 9109920 - 9109786
Alignment:
18 gtatgaggttctcatggatgatcggaaaagggctgagtttaattaccggtggcgggcaggcggtggtggaggaagtggtggtgccggtggaaatgccggt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||    
9109920 gtatgaggttctcatggatgatcggaaaagggctgagtttaattaccggtggcgggcaggtggtggtggaggaagtggtggtgccggtggaagtgccggt 9109821  T
118 aactattattatcagtctcagtatagttatggata 152  Q
    |||||||||||||||||||||||||||||||||||    
9109820 aactattattatcagtctcagtatagttatggata 9109786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University