View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1881_low_10 (Length: 230)
Name: NF1881_low_10
Description: NF1881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1881_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 152
Target Start/End: Complemental strand, 9109920 - 9109786
Alignment:
| Q |
18 |
gtatgaggttctcatggatgatcggaaaagggctgagtttaattaccggtggcgggcaggcggtggtggaggaagtggtggtgccggtggaaatgccggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9109920 |
gtatgaggttctcatggatgatcggaaaagggctgagtttaattaccggtggcgggcaggtggtggtggaggaagtggtggtgccggtggaagtgccggt |
9109821 |
T |
|
| Q |
118 |
aactattattatcagtctcagtatagttatggata |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9109820 |
aactattattatcagtctcagtatagttatggata |
9109786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University