View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1881_low_4 (Length: 303)

Name: NF1881_low_4
Description: NF1881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1881_low_4
NF1881_low_4
[»] chr7 (1 HSPs)
chr7 (17-100)||(37858844-37858927)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 17 - 100
Target Start/End: Original strand, 37858844 - 37858927
Alignment:
17 aaaatctctattcccactttctttgcaccttcttggtcttccaaacttagtcacacccatctcatcttccaccttctcaacaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37858844 aaaatctctattcccactttctttgcaccttcttggtcttccaaacttagtcacacccatctcatcttccaccttctcaacaca 37858927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University